Try to solve the Repeated DNA Sequences problem.
Statement
A DNA sequence consists of nucleotides represented by the letters ‘A’, ‘C’, ‘G’, and ‘T’ only. For example, “ACGAATTCCG” is a valid DNA sequence.
Given a string, s, that represents a DNA sequence, return all the 10-letter-long sequences (continuous substrings of exactly 10 characters) that appear more than once in s. You can return the output in any order.
Constraints:
s.lengths[i]is either'A','C','G', or'T'.
Examples
Understand the problem
Let’s take a moment to make sure you’ve correctly understood the problem. The quiz below helps you check if you’re solving the correct problem:
What is the correct output if the following string is given as an input?
s = “ATATTGGCCAATTGGCCAATTCGC”
[“TT”, “GG”, “CC”, “AA”]
[“TTGGCCAATT”]
[“ATTGGCCAAT”]
[“ATTGGCCAAT”, “TTGGCCAATT”]
Figure it out!
We have a game for you to play. Rearrange the logical building blocks to develop a clearer understanding of how to solve this problem.
Try it yourself
Implement your solution in the following coding playground.
function findRepeatedDnaSequences(s) {// Replace this placeholder return statement with your codereturn ["test"];}export { findRepeatedDnaSequences };